Categories

Archives

A sample text widget

Etiam pulvinar consectetur dolor sed malesuada. Ut convallis euismod dolor nec pretium. Nunc ut tristique massa.

Nam sodales mi vitae dolor ullamcorper et vulputate enim accumsan. Morbi orci magna, tincidunt vitae molestie nec, molestie at mi. Nulla nulla lorem, suscipit in posuere in, interdum non magna.

Down on the farm

Bill Emmott has a marvellously sane piece on food shortages, agriculture, the credit crisis and the case for GM crops. He’s in favour of GM, wants free trade, and is unimpressed by the case for biofuels.

The comment thread attached to Emmott’s article reveals considerable fear and hatred of GM foods. I would like to ask some of the commenters how they imagine most strains of wheat, barley, soybeans or rice that have been staples of diets for centuries came along. They are, albeit through trial and error over eons, just as ‘modified’ as a Monsanto crop. And that I think is the kicker: it is the speed of scientific change, not the change as such, that gives people the heeby-jeebies about genetic modification. I am not sure how that can be easily addressed without massive improvements in popular understanding of science.

53 comments to Down on the farm

  • Andrew Duffin

    “They are, albeit through trial and error over eons, just as “modified” as a Monsanto crop.”

    No, they are not.

    Plant breeding is entirely a natural process at root. All that people do is pick the good strains and let nature get on with the job. The actual underlying biochemistry is the normal ways of plant reproduction, which we are far from understanding fully.

    GM has been altered at the molecular level by manipulating those few small bits of the DNA that we kid ourselves we do understand. Every year’s research in biology shows that we know less and less than we thought.

    It’s akin to making blind modifications to the source code of a huge computer program, while having little or no understanding of how the whole thing works.

    We really don’t have a clue what we might unleash.

    For the avoidance of doubt, I write as a qualified chemist.

  • Johnathan Pearce

    Andrew, but although I defer – up to a point – to your professional expertise – I have to ask what is different in terms of quality between Man-made modifications which happen in a matter of days, months or years and what accidental, trial-and-error cross-breeding? One might as well “unleash” problems via the latter as through the supposedly more dangerous GM format.

    I also have a bit of a bugbear with this whole “natural” vs “artificial” thing. In too many cases, these words are used in a normative sense, conveying a sort of unspoken fear of Man-made stuff generally.

    As for our ignorance of what goes on in nature, I don’t get a sense that we are actually going backwards; rather, there is a huge amount of new information being unearthed all the time but that information is dispersed among millions of people in the scientific and related communities, rather than known to a select handful.

  • not the Alex above

    I think the thing that turned me off GM crops(and a lot of other people) was that companies like Monsanto weren’t coming up with novel ways of improving taste say. Instead they were making their seeds resistant to their very strong weed killers and the like.

    However at my university we are working on loads of GM stuff(mainly to do with drought and pest resistance) and the one that sticks in the mind is a project to help plants(such as plantains) better resist nematode worms which infect the root system and effect plant healthiness and crop yield. Not by covering the earth in toxic chemicals but using its own defences. That is much better

  • not the Alex above

    aaarghh – plants not seeds

  • Ian B

    it is the speed of scientific change, not the change as such, that gives people the heeby-jeebies about genetic modification

    I don’t think that’s it. The GM panic was one of the major things that forced me to reassess my worldview and led me ulimately to stumbling into libertarianism. I’ve always been a “pro science” kinda guy, and my instinct is to be what I now term a Science Loyalist- somebody who automatically takes the institutional science view as a matter of instinct and defends it to teh death. It was GM that made me realise that something was going terribly, terribly wrong with our society.

    People are scared of GM because of a highly orgnaised, well-funded propaganda campaign by the vast nebula of environmentalist/ruralist/pastist campaign groups; the anti-progress progressive left. At the time, I was shocked and awed by how fast they were able to marshall their forces to create a false controversy (the very thing they always accuse their enemies of doing, of course). I remember watching a typical BBC rigged debate in which a scientist (can’t remember who, sorry) was absolutely taken to the cleaners by some Greenpeace twat (spectacles too big, cropped hair, mock estuary accent, you know the type) simply because the poor scientist was trying to discuss the issue rationally while speccy berk was squealing “can you prove these won’t disrupt the carbon cycle and destroy all life on Earth?!” which the scientist, ill-schooled in dealing with moonbattery, couldn’t of course.

    Just as in another thread I suggested that the Battle Of The Beanfield was the turning point in our policing, the GM campaign was the turning point in science. It was the point when the scientific community learned that they would only be allowed to operate with the permission of the Greens, the point when only theory and practice deemed acceptable to the environmentalist alarmists would be allowed. It set the stage for the carbon tyranny.

    This wasn’t anything to do with what ordinary people think about science. Ordinary people didn’t care, any more than they care about trans-fats or salt or cholesterol. It was an organised campaign by the Fifth Column, and we need to recognise that. What’s to be done with the Greens? I suggest that we announce that the world’s largest combined nuclear power station and genetic modification research facility is to be built somewhere on the coast and then, when they’ve all arrived to protest, we gently, but firmly, herd them into the sea and their bleating is silenced by the waves rolling over their heads.

  • DavidNcl

    Johnathan writes…

    “I am not sure how that can be easily addressed without massive improvements in popular understanding of science.”

    True but not enough.

    What’s needed is some kind of popular understanding of the nature of the anti-enlightenment collectivist forces that we confront. At the heart of the canvas cleaning collectivist world view is the craving for naturalness, cleanliness and purity (of food, folk, forests and the imagined simple life of peasants). We need to establish a “twitch reflex” in the body politic which can identify at a glance the whole anti-reason, belly think Rousseauean trip and spot it in the anti-GM or anti supermarket or anti-car or anti-globo mob or the warmista and see that they are all the same at heart.

    This is really quite a serious business too. It is this particular unreasoned yearning for the perfection which can never be that leads directly to very dark places. The Terror (and actually, the original holy terror), The Great Terror, The Shoa, The Cultural revolution, The killing fields… mounds of dead, monuments made of piles of skulls; all these are a result of the urge to make a perfect, pure Rousseauean society.

    Hack that into the meme-context please.

  • Nick M

    Andrew,
    No we don’t know what we’ll unleash but let’s give it a go? It is not entirely disimilar to selective breeding. And to vaguely suggest that that doesn’t operate at a molecular level is bizarre. Of course it does. A Dachshund doesn’t look like a Great Dane without having differences in DNA.

    Frankly you sound like the kinda guy who supported having a geezer with a red-flag walking in front of motorcars.

    You’re a scientist. Ever wanted to steal fire from the gods?

  • knirirr

    Andrew,
    If we were to press the analogy of modifying the source code of a computer program then such modifications would be the equivalent of modifying a function (or subroutine, if you prefer) the role of which is known. This is not quite the same thing as the “blind” modification you mention.
    Also, we do have some clue what we might unleash. Plenty of study goes on into the likely effect of transgenes when exposed to natural pathogens and the likelyhood of those transgenes escaping into the wild.
    I should also point out that “conventional” crop breeding methods have involved radiation mutagenesis well before modern genetic techniques were developed and that doesn’t seem to bother anyone.
    I write as a qualified biologist and programmer, with the caveat that I am now employed in the latter capacity.

  • (1) IF we don’t grow enough food, then people will die.
    (2) WHICH people?
    (3) If humans have rights. then it’s our responsibility as good libertarians to uphold those. That means enough food for a start. AND enough of the right kind which is to say lots of animals ground into the food, so we do need to raise absolute volume so as to feed the animals that people need to eat also.
    (4)Andrew 12.34pm you’d be amazed at what we (Man)know about DnA and how it all runs and is driven. You’d be amazed at what we even knew in 1973 when I graduated (I’m a biochemist by the way) which by comparison with 2008, was jack-shit-nowt.
    (5) I have had enough of wrestling at dinners etc with Nazi-nordic-mythology-neopastoralists (which is to say, “greens” and other sorts of collectivist) who hark after a sort of *rousseauean* “Golden Age”, and who say things like “basically, we MUST (their caps not mine) go back to being subsistence farmers”…( an actual phrase, uttered to me by a real person last year, and he was standing up and sober.) I queried the words “must”, and “back” and “subsistence”, and then I felt that our hostess was getting upset with me, so I backed off as would have been polite.

    We have been too polite to people like you, Andrew, for too long. Sorry. Either the planet and all its software is for Man, or Man is for the planet and all its software. Which do you think is true?

  • Gregory

    Having a body of general knowledge that I daresay would be up to par with most of the lot of you, let me put my oars in this discussion…

    Dogs, by and large, can interbreed with each other, because they are of the same species. In many cases, individuals within the same genus can cross-breed, and not all of the offspring will be infertile/sterile. However, you do not normally get to breed a dog and a cat and expect offspring (cartoons notwithstanding) from this process.

    What is done in ‘standard’ agricultural practice, is really ‘artificial selection’ (using natural selection to get the results we want). By this method, we get better strains of rice, black tulips, and many other advancements.

    I think what scares people off from GM, assuming they understand the science behind it, is the fact that you no longer restrict yourself to the species/genus boundaries. I remember reading about scientists modifying bacteria with the genes for manufacturing spider silk, as well as genes to digest milk, so that you can have bugs that spin spider silk from milk. Which is pretty cool. In the same Reader’s Digest article, they mention that they were splicing petroleum-eating genes into those selfsame bugs, so that they can literally eat up oil spills, then kill themselves off (suicide genes, of course) once the concentration of petroleum drops below a certain level, so that they don’t crawl off the ocean and into your fuel tank. Which would be a major bummer.

    Science is not a field of study for the arrogant. You can be confident of your results, but the latest word is never the last word. If you splice silk-making genes from spiders into bacteria, who knows what else you might have inadvertently included? This is, I consider, the root fear behind the rejection of GM foods.

    Having said all this, I’m all for GM stuff. If you can make a tofu burger taste exactly like beef, and still be fat free or whatever, what the heck? The best thing would be to GM pig genes into *everything*. But that’s mean of me.

    And imagine if you could engineer bacteria that *created* petroleum… 🙂 Shit, we could embargo the whole Middle East!

  • The pace of change can be important. If you are driving down the road, it’s one thing to drive at 30, quite another at 100. After a while, rapid change can begin to feel like a Red Queen’s Race, where it takes all the running you can do to stay in one place.

    “You don’t understand” and it’s friend, “we must educate you” is all very well. But however brilliant we may be in one field, we’re dullards and ignoramii in others. I don’t really want to have to learn everything. A bien-pensant on one noontime Public Broadcasting show was talking about the problems immigrants have in finding stable employment. He suggested employers should try to learn their language.

    Fine, I thought. Should I start with Somali, Hmong, or Spanish? We have large numbers of all in Minneapolis. But pretty soon I was muttering instead over the arrogance of some guy putting that large a task in front of people when he himself would never deal with it.

    And there is where a lot of the trouble lies. I simply do not want to have to learn how to operate Tomato V2.04. And how do I know the manufacturer hasn’t put something into it to get me hooked?

  • Gregory – if you really want to give the Middle East the whim-whams, engineer pig genes into the bacteria that create petroleum.

  • The point is that these people are willfully ignorant of science.

    I have attempted to explain to people about nuclear power and they just metaphorically stick their fingers in their ears and shout “la, la, la!”

    I have two degrees in physics. It don’t move ’em.

    I despise them and frankly, they should get exactly what they want. We should have a nature reserve for them where they can enjoy their rural idyll and eat dung.

    And when they get sick, which they will very quickly, the NHS can provide them with leeches.

    To be honest I wouldn’t mind if the whole bally lot were made permanently carbon neutral as fertilizer for GM crops.

    The Greens are worse than Nazis in my book.

    What I would like to do to Al Gore is indescribable and would make Vlad the Impaler quiver. It would not be over quickly and he would not enjoy it.

  • Nick –

    That’s a bit over the top, but while you’re at it, could we get Jeremy Rifkin in on the fun?

  • I think the fear of GM crops stems from a quite healthy caution regarding man’s propensity to meddle in things which he doesn’t quite understand. Not that such meddling is a bad thing, we only gain greater understanding through such meddling. The problem is that the few bad things which have happened due to our meddling have been very bad indeed. Or maybe its all Mary Shelley’s fault, man’s ambition often outstrips his ability to deal with the consequences.

    Einstein bemoaned the use of his theories in the development of nuclear weapons, and I’m sure Louis Pasteur is rolling in his grave at the thought of some of the man made bio-weapons which his original discovery made possible. We fear our own abilities and the catastrophies they may unleash. Caution is all very well but when it interfere’s with progress, towards making our world a nicer place to live or a greater understanding of the universe, then we should take the doommonger’s proclamations with a hefty pinch of salt.

  • tdh

    I don’t have a problem with the pseudo-scientists who prefer to be guinea pigs, and who pretend to have a far more comprehensive understanding of complex phenomena than they actually have. I don’t have a problem with their myrmidons, either. Let them win or lose on having guessed correctly on a matter that is normally resolved in an evolutionary timeframe.

    But one problem with GM crops is that they contaminate nearby non-GM crops, so that consumers of the intended latter unwittingly become consumers of the former. I suppose that this can be dealt with via the tort system, to the extent that it has not been hijacked, whether or not the unknowns would ultimately prove to be harmful.

    FWIW, the discovery of epigenetic influences reflects an understanding acquired in non-scientific times, but denied for a long while during scientific times, that more than merely one’s own parentage, own environment, and own diet affects human development; the environment-versus-heredity debate involved a false choice. The use of GM crops preceded if not this discovery then at least its widespread propgation. Since this is still, apparently, a major area of research I presume the casual advocates of the consumption of GM crops to have access to far more advanced knowledge than that of researchers.

    Having grown up in a time when the margarine-is-good-for-you and leeches-are-bad-for-you myths were considered a matter of scientific opinion, I’d rather choose my own path, instead of having some pretentious ass try to browbeat or cheat me into taking theirs.

  • permanentexpat

    I wonder…would those among the Greens, Luddites & sundry fellow-travellers unfortunate enough to be suffering from Diabetes prefer to continue their use of synthetic Insulin…or rather produce it, naturally, themselves? (I am tempted to elaborate, but am, with great difficulty, desisting.)
    The crass stupidity of these folk is beyond belief…almost.

  • People are scared of GM because of a highly orgnaised, well-funded propaganda campaign by the vast nebula of environmentalist/ruralist/pastist campaign groups; the anti-progress progressive left.

    Yes, that’s it.

    Primitive people are afraid of everything, especially anything new. For example: Rev. Wright (Obama’s pastor) believes that the white people infected negroes with Aids to kill them. Suha Arafat once told her chum, Hillary Clinton, that the Jews were poisoning the water of the Arabs to get rid of them (not a bad idea…).
    The greens are basically primitive people who fear new things. That is – most are. The rest are professional fear mongers. Fear mongering is easy, there are lots of receptive dumb people out there. So people make a career out of fear mongering. Marx was such one. Those that agitate against cellular phone antenas are scare mongers, against nuclear power… etc.

    Life involves risks. Driving a car is risky, we still do it, the benefits justify the risks.
    GM isn’t risky, as far as we know. If there is some unknown risk – it’s probability is small. We cannot kill all innovations because of those supposed unknown risks, as the luddite nutters demand.
    On the other hand, the downside of not using GM crops is not unknown but very clear, and it is called hunger.
    (Full disclosure: I’m not a chemist).

  • Mandrill

    Einstein was the principal instigator of the Manhattan Project. It was his letter to FDR, which he wrote at the request of Edward Teller if I remember correctly, tht started the whole shebang.

    He might have complained later when it was used as an instrument of US power vis a vis the USSR, he was after all a Euro lefty.

  • I was not being over the top. That’s what I believe and I have no intention of going back to medieval barbarism although I make an exception for Al Gore and Jonathon Porritt. These people are evil.

    I want to live in a prosperous, technological society. I want to read of scientific advances. I don’t want to die from hunger or from some shitty disease that they get in the third world. I want to live to see my species land on Mars and take the hypersonic to Australia and quite frankly if these neo-luddites don’t want that they really can fuck off to wherever they want to create New Eden.

    The end point for Nazis was Auschwitz. The end of Communism was the gulags and killing fields and people eating their own children. The end point for the Greens is the same. Just look at some neo-luddite websites. Some of these fuckers reckon we went wrong by discovering language. Not written language either. Not even Lenin, or Mao, or Hitler or Pol Pot’s Year Zero had that awesome ambition.

    And you ask me why I hate them?

    Since Newton and Galileo, Stephenson and Tesla we have had something that in the 50,000 odd years of our species we have never had before. The Ionian and Minoan civilizations almost got there. The Chinese and Indian might at times have come close. Hell, it almost happened hordes of times but it never quite worked out and something always miscarried. What we have is precious because it’s fragile. We almost broke through to the sunlit uplands so many times and only finally made it stick when the Principia was published. Well, when I say “stick” I mean so far. It is not a given and it is something we take way too much for granted.

    We are three meals away from dancing naked painted in woad. And people wonder at my intemperate language at a bunch of useless, decadent cunts who want to discard a potentially useful technology like GMO for reasons which are so fucking obscure as to be practically theological.

    No, sorry, no can do. In the UK HRH Prince Charles is a leading light for the no GM thing. Well, fine. He can afford all the organic carrots in the world. He owns half of Cornwall. He’s not gonna go hungry. Neither am I but then I suspect I am happier with a humbler meal than the heir to the throne and grand high poobah of jackassery within the UK.

    I did sixth-form work experience with a team attempting a “frankenstein food”. It was funded (poorly) by the FCO. It was cassava. It was an attempt to remove the toxin that mean people in a large chunk of the third world have to repeatedly beat and soak, over 48 hours, their staple source of calories. When Charlie and Jonny and all the rest of them offer to go out to Africa and personally beat and soak cassava then I might not call them for the gits they surely are.

    Can you imagine if these potless folks could sow easier to prepare cassava the amount of hours of human labour that would be freed up? Those people might then have a shot at being more than marginal subsistence farmers.

    And who the hell is Jeremy Rifkin?

    Oh, right, Wikipedia sorted that out. What a twat. Yeah, if he came round my gaff he can expect a profound kicking in the Pilgers. And up the bracket and elsewise.

  • RRS

    The history of the largest sector of Monsanto’s seed business, Dekalb Hybrids, should help in understanding these developments.

    Dekalb Hybrids originated from the efforts of a farmer’s co-op* to improve corn (as well as other produce). The traditional methods of “husbandry” were used. As a youth, this writer placed bags over the silks and cut tassels in Dekalb County back in the 30s. All that effort was necessary to grow the hybrid seeds, as well as produce “better,” or at least different, hybrids. Now, with less effort we have more, and are even able to adapt strains to particular soils and growing conditions.

    It should, by now, be acceptable for all sectors of agriculture to improve and reduce efforts by selectively adopting what has been developed to date; not that everything has to be taken in – but everything should not be ruled out.

    *disclosure: writer’s grandfather (b. 1856) was one of the organizers of that co-op.

  • Nate

    Of environmental lobbyists he [Dr. Borlaug] has stated, “some of the environmental lobbyists of the Western nations are the salt of the earth, but many of them are elitists. They’ve never experienced the physical sensation of hunger. They do their lobbying from comfortable office suites in Washington or Brussels. If they lived just one month amid the misery of the developing world, as I have for fifty years, they’d be crying out for tractors and fertilizer and irrigation canals and be outraged that fashionable elitists back home were trying to deny them these things”

    From what I recall, Dr. Borlaug thinks GMO is the way to go. His resume seems to imply that he has some experience in agriculture.

  • Gosh, Nick M (06.14pm) what an essay. I should like to be able to dash off stuff like that, one day. Please archive it and use it around the planet.

    At least I am not any more alone in thinking how staggeringly, unfathomably evil the greenazis are.

    I have not googled “greenazis” ever but believe I have invented it, in about, er, 2003. Perhaps first used on “eurorealist” (http://yahoogroups.com/eurorealist)

    The “threat”, posed by “militant Islam”, is nugatory by comparison with greenazis and animal “rights” activists – both of whom I say are far far more dangerous to humanity long-term, and are frequently the same people, so the “taking-out” operation against them ought to be thus simplified.

  • Roger Clague

    I have enjoyed the rant from Nick M, and agree with the sentiment well expressed.

    However to describe reasons as , ‘obscure’ and ‘theological’ is not enough.

    What motivates Greens?

    Charles Windsor and Jonathan Porritt want to continue their comfortable life at the expense of the chance of a better life for most people. This is evil but also self-interest.

    Greens calculate that the big changes they know will come from genetic modification (GM ) will weaken their power. Which is based on, the soon to be replaced, older technology of breeding.. That is agricultural advance by making changes in whole organisms, cows and plants we can see being replaced by GM which works at the invisible molecular level and can mix properties from different species. They are Luddites.

    However many other people accept their backward ideas because they are not confident of the ability of scientists to do good job. I am am a science teacher and I have some sympathy with this prejudice.

    We all should be able to give a short and convincing argument in favor of GM. And use when ever possible.

    I had better have ago at writing down mine.

  • It’s akin to making blind modifications to the source code of a huge computer program, while having little or no understanding of how the whole thing works.

    That’s not so difficult. You sit down and learn the whole thing then you do what is needed. I know, I did it a couple of times. That’s how normal men do things: by learning. It’s the ignorant who believe (or claim) that the people who do GM crops don’t know what they are doing.

  • Ian B

    Following on from Jacob’s point above, I think we also need to remember that evolution is “making blind modifications to the source code of a huge computer program, while having little or no understanding of how the whole thing works” all the time.

    One of the key myths of science-related activism might be termed “The Myth Of Fragility”. There is an unwarranted presumption of a fragile and delicate balance in all these politicised science issues, be it the fragile ecosystem, the fragile human body, the fragile climate system. There is a generalised belief that these systems are delicately balanced and the slightest perturbation will send them spiralling off into catastrophe. This is demonstrably untrue, since any such delicate system would spiral off at the slightest provocation, whether anthropogenic or otherwise, and that clearly hasn’t happened historically. Rather, we should characterise these systems as robust.

    To use a trivial example, consider the plants in my garden. They have been heavily genetically modified by humans to be most attractive to us (or to produce the tastiest foods, or for some specific-to-humans purpose). But they are not, in terms of the broader ecosystem, very fit organisms. If I leave my garden alone, most of them will be rapidly overwhelmed by those organisms which have evolved for fitness- weeds as we call them. The local ecosystem will return to its default state, and the human interference of creating a garden rapidly erased. Likewise, a GMO crop is unlikely to present any threat to the natural world, since it has been modified to be most useful to humans, not to be a fitter competitor than the evolved plants whose only evolutionary imperative has been to be the most successful reproducers. We aren’t “tampering with something delicate” at all.

  • RRS

    I wonder if there is not a deeper cultural issue here:

    Should we cease trying to learn (obtain facts, observe relationships, etc.)?

    If we do learn should we not apply what we learn to our living and its challenges?

    Should we like the Chinese for so many years of scholarship, learn much, put it on Mandarin shelves, and never deploy it for what it mught add to human life?

  • Ed Snack

    It is also a myth that non-GM food crops are somehow particularly naturally bred. Most are the products of breeding techniques using hard radiation or mutagenic chemicals on the plant genome followed by selection of likely cultivars.

    This process is, as one can imagine, somewhat haphazard and can produce dangerous modifications as easily as useful changes. However, unlike GM crops, there is no specific framework in place that requires any such crops so developed to undergo testing to ensure safety. At least one product (a potato) did in fact get as far as trial planting before being discarded because the levels of natural but none the less dangerous chemicals was excessive.

  • We aren’t “tampering with something delicate” at all.

    That is true even more about the climate.
    Life exists on this planet some 4 billion years. That is 4,000,000,000 years. During all that time climate hasn’t spiraled to life-destroying extremes. The scientists (Hansen) who say it will do so in the next 30 years are far too enamored in their little computer games, and have lost all sense of reality.

  • Ian B

    “Not the Alex above” said-

    I think the thing that turned me off GM crops(and a lot of other people) was that companies like Monsanto weren’t coming up with novel ways of improving taste say. Instead they were making their seeds resistant to their very strong weed killers and the like.

    -and that doesn’t seem to have been addressed. It seems quite natural to say “damned corporations, going after the dollar and addicting farmers to their products” in the standard anti-capitalist way, but then it seems quite natural to us because we don’t necessarily understand the problems farmers face. Let’s ask Norman Borlaug, who does…

    Central African farmers don’t have any animal power, because sleeping sickness kills all the animals–cattle, the horses, the burros and the mules. So draft animals don’t exist, and farming is all by hand and the hand tools are hoes and machetes. Such hand tools are not very effective against the aggressive tropical grasses that typically invade farm fields. Some of those grasses have sharp spines on them, and they’re not very edible. They invade the cornfields, and it gets so bad that farmers must abandon the fields for a while, move on, and clear some more forest. That’s the way it’s been going on for centuries, slash-and-burn farming. But with this kind of weed killer, Roundup, you can clear the fields of these invasive grasses and plant directly if you have the herbicide-tolerance gene in the crop plants.

    It’s easy to jump to conclusions, especially about subjects one doesn’t really have experience of at the sharp end.

  • Kevin B

    Just to re-iterate what Ian B said above, the words delicate, balance and nature do not belong in the same sentence.

    The words that do belong are robust and dynamic.

  • dr kill

    Opposition to GM plants and animals involves a perceived health risk for some segment of the population or the enviornment. Some would also employ various ethical arguments.

    While no thinking person could categorically dismiss these views, neither could they ignore the superior risk/benefit calculus of GM.

    The big Agtech companies aren’t doing farmers any favor, just keeping food cheap. Every year feeding your family costs less- check the USDA.

    * disclosure- for 26 years I was a 10th generation Pennsylvania family farmer. My grandfather (b. 1903) used to tell us boys, that his grandfather used to say he hoped to live long enough to see food get expensive. I doubt I will live long enough, either.

    * for RSS- In the late 70’s I was the proud wearer of a DeKalb ‘winged ear of corn’ baseball hat. It was cool.

  • Pa Annoyed

    Even when we don’t use radiation and mutagens, the natural process still provides no guarantee of safety.

    The normal method of meiosis is to take the genomes of two different organisms, line them up, then chop them up at random and swap the bits, like one of those children’s picture books where you swap the heads and bodies around, before finding out if the result is viable. Quite frequently, the result doesn’t even survive beyond the single cell stage. If a lab did that, and let the results escape untested into the wild, what would you think?

    There’s also a lot of interference from parasites. The mammalian genome is about 8% retrovirus – viruses that have infected the germ line cells and got incorporated into the human genome. (24 have entered since we split from the chimpanzees.) Huge amounts of the genome are simple-minded repetitions of the same nonsense sequence …CATGCATGCATGCATGCATGCATG… and the like – the result of rogue genes that cut and paste themselves randomly into other parts of the chromosome.

    Even when the process goes right, the result is still not safe, especially in the case of plants. It should seem obvious that plants, genetically speaking, do not want to be eaten. They face a constant battle against predators of all sorts – insects, bacteria, fungi, viruses, animals. Not being able to run away, their main defence is chemical. They load their flesh with toxins – natural pesticides constructed to disrupt and interfere with non-plant biochemistry, a thousand times more of them than any artificial ones we add. And since the pests can evolve resistance within decades, the plants too must evolve new pesticides on a similar timescale. The plant might look the same shape that it did, but that’s no guarantee that it is chemically at all similar. It does its radical chromosome scramble precisely in order to invent new, random bioweapons for killing plant eaters.

    And as for the idea that there’s anything special about genes crossing species – we already share 90% of our genes with mice, 75% of them with worms, and 50% of them with plants. There are certain genes that we might share with other species that we don’t share with our next door neighbour. Blood groups, for example. If you have blood group A, then you share a gene with certain chimpanzees who also have blood group A that your neighbour with blood group O does not have. If you trace the family tree of the blood group gene back, you find the ancestries split before some on each side of the divide became human.

    A species is defined by the genes of two organisms being such that the result is probably still viable after it’s gone through the meiosis blender – their boundaries are a lot fuzzier and more arbitrary than the taxonomists pretend. There is no distinction – genes are not ‘flavoured’ with the species they come from, they are simply code – words written in the same language. We are all one family, the same kind of thing, our similarities greater than our differences. Genes from one species will feel right at home in another, finding themselves among many old neighbours. They are no more or less likely to work for being from another species than a local one – 2-4% of humans are born with genetic defects that are examples of genes messing things up. You think any lab could be so bad?

    Genetic engineering is not ‘safe’, but it is far safer than the randomness of natural reproduction – which makes frequent botches and invents new and virulent threats to human existence every year. The difference is only that we put Nature’s many mistakes down to being just the way life is, while we set ourselves an impossibly higher standard. It is called the naturalistic fallacy.

    If you live in the jungle and want to cross a river, you can either search for a not-too-rotten tree that has fallen across it, or you can chop down lots of trees on the river bank and hope some fall in the right direction and hold in place when you put your weight on them, or you can saw a tree up into planks and build a bridge. Which process has the potential to be safest?

  • Gregory

    Dear Dr Ellen;

    Ooh. Now *that’s* evil… 🙂

    Hmm, I did not know about the mutagenic stuff they’ve been doing in standard agriculture. But I’ll bet you if this was made more widespread knowledge, even the organic farmers would go nuts. Heh. Organic farming is for the dogs – give me my pesticides, herbicides and battery farm chooks anyday. I’ll take my chances.

  • joel

    GM foods are just the product of technology. They can be good or bad.

    I read a while back that some kid died or got very ill because a peanut gene was spliced into another food and he was allergic to peanuts.

    The epidemic of eosinophilic myalgia may have been due to a genetically engineered bacterium that produced way too much tryptophan (by design), resulting in dimers and allergenic protein in people who took the tryptophan pills.

    So, there is ample reason for caution, but, like fire, we have learned to control it. But, expect bumps. Caution is clearly called for.

  • RRS

    Dr. Kill:

    Be happier! You did not become a Pioneer (Pie-on-ear)
    and thus support Henry wallace!!!

  • RRS

    It is surprising that there has been no reference to the use of hormones in certain levels of food production.

    Example Monsanto’s BGH.

  • The_Wobbly_Guy

    Well, you can be sure of one thing: China’s not going to stop using GM foods if it means solving their agricultural and food problems.

    What’re the greenies gonna do? Protest?

  • Ian B

    What’re the greenies gonna do? Protest?

    They’re pushing for protectionism, sanctions and other forms of economic warfare. Remember, they’re trying to shut down the global economy anyway, so it all dovetails nicely.

  • Opposition to GM plants and animals involves a perceived health risk for some segment of the population or the environment.

    What health risk ? Has anyone identified a risk ?
    The stuff has been tested and no risks have been identified. The “perceived risk” is just imaginary, it’s the fear of the new and unknown.

  • Ian B

    It’s not fear of the unknown, Jacob, it’s hatred of progress. Every step forward we make gives the lie to marxism. To the reds (green being the new red), that is intolerable.

    It’s the same as the panic about climate. They need to get the tyranny in place before it’s shown to be false.

  • Nick M

    I wonder if there is not a deeper cultural issue here:

    Should we cease trying to learn (obtain facts, observe relationships, etc.)?

    Not exactly. The Green movement is essentially Orwellian. Truth is what they say it is. They get away with a lot because so much is essentially untestable.

    The Greenhouse effect remember was first spotted on Venus. Google what Venus is like (it’s horrible). It’s very different from here. It’s an appalling analogy.

    It’s like religion but unlike religion it has a deep interest in politics, law-making, taxes and regulations. Now if, say the bloke at number 4 believes in the flying spaghetti monster or the trinity or shiva or whatever it makes no odds to me. But if he’s a deep green then he probably wants to smash my car or poke through my bins and report me to the eco-police. Put it this way. I am not a Christian but I could happily live in the USA which is the most Christian nation in the developed world. The fact that a majority of Americans attend church on Sunday would matter not a jot to me.

    You can’t say the same about Greens because there is no render unto Gaia what is Gaia’s because everything is Gaia’s. They probably spout off some demented misreading of “Native American lore” about belonging to the earth. It is essentially totalitarian.

    The UK is a small densely populated island. It is almost totally artificial. It is the work of generations of Brits. Our countryside is by and large as artificial as our towns are. A lot of UK Greens don’t get that. They don’t get that going out into the sticks pretty much anywhere in this country is not going into nature.

    We have bitch-slapped mother nature into line and managed the land for our benefit and the result is a rich country with a high standard of living. We’ve been “exploiting” Gaia for thousands of years. We deforested huge areas, drained swamps, altered water courses, built cities and suddenly driving a few cars and flying in planes and having electricity is going to doom us all?

    Oh, and finally. Meddling with things we don’t understand is what scientists do. It is the definition of science. Would you give a research grant to someone to find out something we already knew? If I’d gone to PPARC and said, “Well, basically my thesis is that the Earth isn’t the centre of the universe” they would have told me to fucketh off.

  • Slightly OT: a lot of my favourite snack foods have had their additives removed. “Same great taste” my arse! I’m sure a lot of the arguments put forward here about the mindset of anti-GM folks apply to their thinking about food additives, too. (Incidentally, this thread is a stunning example of the high quality of Samizdata comments; I’ve learnt a lot.)

  • Bod

    To Nick …

    It’s like religion but unlike religion it has a deep interest in politics, law-making, taxes and regulations.

    Maybe unlike most religions – I doubt you’d find a libertarian anywhere that would rather live in Riyadh than Knoxville, TN.

    We could start a whole new thread highlighting exactly how the Green Movement and all the other nu-luddites really are nothing more than religions.

    Rob – it may not literally be the same great taste, but the holistic experience makes your taste buds better Global Citizens.

  • Nick M

    Bod,
    I deliberately left Islam out. I couldn’t at the time be bothered explaining why it was different. I’m glad someone called me on it though.

    Greenism, Islam and Communism are all sort of religions but they are intrinsically also political movements.

    Reading Dawkins “The God Delusion” (I didn’t buy it) made me realize something. “Religion” is a truly inadequate word. Different religions are very different and I’m beginning to think sufficiently so that they shouldn’t be classed together as the same thing.

    In a sense the three offenders I mentioned earlier are pseudo-religions, quasi-religions. They dress themselves in the clothing of religion, they use the rhetoric, they appeal to blind faith but they, at heart, aren’t the real deal.

    That’s not saying that I believe in The Gospels or the Torah or any of the rest. It’s just that I think Buddha or Christ or Zoroaster or whatnot were honest men whereas I think Muhammed was either totally unhinged or a complete charlatan. Possibly both. I tend to think the same about most Greens and what I think of Lenin is XXX rated.

  • Alisa

    Nick:

    Different religions are very different and I’m beginning to think sufficiently so that they shouldn’t be classed together as the same thing.

    Absolutely. I prefer the term ‘ideology’ to describe them all, including the non-offensive ones. All of them are based on an idea. In some of them that idea is embodied by some higher being, and in some of them it isn’t.

  • John McVey

    Nick & Alisa

    The word you’re looking for is philosophies.

    Advanced religions have definite views on the fundamental nature of the universe, how we learn about it, our place in it, and what the nature of value is. That then leads to definite ethical theories. Those ethical theories also have definite implications for political theories, where some religions either include political theory as a worked out system or at least have a central idea for one.

    Greenism and communism ostensibly start with the politics, but those are based on implicitly held views on what is ethical. In turn, that’s based on implicit views of what the nature of value is and our place in the universe accordingly. All that is in turn dependent on implicit views about the nature of the universe and how we learn about it.

    Those implicit ideas held by the greens etc did not pop out of nowhere, fully formed, like Minerva from Zeus’s head. People got them, or their bases for them, mostly from their feelings (which some people deny starting from or using as the guide). From there, some then purported to think up new thoughts – though to be fair sometimes they came up with new angles and new details, but that’s it. Where do you think the origin of those feelings lies? Who, until somewhat recently, had mostly controlled what schooling their was for the last 2000 years? Whose basic ideas (not the details, I mean the real fundamental basics) about the universe and value have not been questioned in all that time except by a rare few?

    It’s no surprise at all – at least to us Objectivists – that greenism and communism share a great many key similarities to religions, without them expressly being religions. There is only one class of source for their feelings about the universe, about our capacity to learn about it, and about what the origin of value is. All the modern anti-progress anti-freedom thinkers claim to be so original, so fresh, so vital, yet in truth at root they’re staggeringly cliche’. No bloody wonder it’s really just the same old shit with the same motives.

    JJM

  • Alisa

    John, I disagree. Obviously I considered ‘philosophy’, but rejected it. The reason is simple: ‘philosophy’ is the ‘idea’ in ‘ideology’. A particular ideology is a direct (although not a sole one, nor a necessary one) product of a particular philosophy.

    Yes, Greenism, like Socialism, and other “secular” isms, have some of their roots in Christianity, and the latter has its roots in Judaism, and Islam has “stolen” bits from both. And I don’t know much about Buddhism, but it doesn’t look much like religion anyway. The moment any of them began influencing political platforms, we begin discussing ideologies.

  • Gregory

    Dear John;

    I would prefer to call it metaphysics, myself. At heart, everyone needs to have answers to certain questions;

    1. Why am I here?
    2. Why is everyone and everything else here?
    3. Where are we headed?
    4. How does everything relate to each other?
    5. What incentive do I have to keep living and doing what I’m doing?
    6. What happens after I die?

    These questions, quite frankly, can only be answered by knowledge gained through the scientific method on the material and physical level (I mean, Sex Ed pretty much takes care of Question 1 on the physical level, right? right?), and not the metaphysical level, since what we call science (the scientific method personified by Sir Francis Bacon) does not deal with that level.

    So, whatever framework you use to deal with these questions is your religion. Even if your answer is ‘I don’t give a shit’, or ‘It doesn’t matter’ or ‘It’s not relevant’.

    Every other animal may be smart, intelligent after a fashion, but AFAIK, none of them have to struggle with these questions. Of course, I know some humans don’t really think about these things either, but these issues do crop up, and religion is whatever is used to answer these questions.

  • Alisa

    On second thought, ‘ideocracy’ may be a better term, as originally, the meaning of ‘ideology’ was similar to that of ‘philosophy’, and I prefer to stick to the originals when possible.

  • Paul Marks

    People who followed Karl Marx himself would be in favour of the new technology (risks and all) – as what used to be called the “Living Marxism” people are.

    However, most leftists now follow the strain of Rousseau in Marx – far more than Karl Marx did himself.

    “G.M. carries risks” – quite so, that is why there should be unlimited tort action available against companies, in order for them to take safeguards against risks.

    Of course, in the long run, food will (unless the Greens get their way and civilization collapses) be produced in bio factories – not farms our in the environment.

    “But that would be terrible”.

    What is the alternative?

    After all even at this time of sky high food prices we are told that American farmers can not get by without three hundred BILLION Dollars of taxpayer subsidies.

    That can not go on.

    Of course, New Zealand farmers manage to be profitable without any subsdies at all – but surely the American (and European) farm lobby can not be telling lies.

    “But it is the regulations and the taxes”.

    New Zealand taxes are almost as high as British taxes (higher than American ones).

    As for the regulations – O.K. get rid of them, and get rid of the subsidies.

  • cj

    I don’t have a “problem” with the concept of GM foods, per se.

    The relevant issues, as I see them: patents and control of seeds; non-diversity of crops, leading to possible crop blights (I know this is a problem with ‘natural’ crops, but I think our food technology should be dealing with this issue, and I’m not sure GM/patent-lead research weighs this issue substantively).